Journal: Cell chemical biology

Article Title: Proteomics of broad deubiquitylase inhibition unmasks redundant enzyme function to reveal substrates and assess enzyme specificity

doi: 10.1016/j.chembiol.2020.12.007

Figure Lengend Snippet: Key Resources Table

Article Snippet: This study ProteomeXchange Consortium Experimental Models: Organisms/Strains Adult female Xenopus laevis Colony bred/maintained at Harvard Medical School Oligonucleotides (see Table S7 ) ING2 forward CAACTCTATAATACGACTCACTATAGGGAACAGCCACCATGCCTCTTTTTGCCACCAA This study ING2 reverse TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACCTCGATCTTCTATCCT This study SYF2 forward CAACTCTATAATACGACTCACTATAGGGAACAGCCACCATGGCGGCTATAGCTGCATC This study SYF2 reverse TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGACAGCTGTTCCTCTTT This study RBM18 forward CAACTCTATAATACGACTCACTATAGGGAACAGCCACCATGGAAGCAGAAACCAAAAC This study RBM18 reverse TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCATCTTCGAGATTTCCATG This study PIM3 forward CAACTCTATAATACGACTCACTATAGGGAACAGCCACCATGCTTCTCTCTAAATTCGG This study PIM3 reverse TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACAGACTCTCGTTGCTTG This study RNF138 forward CAACTCTATAATACGACTCACTATAGGGAACAGCCACCATGGCCGAGGACCTCTCTGC This study RNF138 reverse TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGATGTTTACTTGAAAAG This study Recombinant DNA Plasmid: pLDNT7nFLAG-CSNK1D DNASU HsCD00618006 Plasmid: pLDNT7nFLAG-CSNK1E DNASU HsCD00618070 Plasmid: pLDNT7nFLAG-MKRN1 Lee et al., 2009 Addgene 78751 hORFeome Database Harper laboratory Harvard Medical School N/A Software and Algorithms MS Convert Adusumilli and Mallick, 2017 http://proteowizard.sourceforge.net/tools/msconvert.html Quantity One software Biorad www.bio-rad.com/softwaredownloads Open in a separate window Key Resources Table Proteomics coupled with broad DUB inhibition reveals new DUB substrates This method identifies both degradative and non-degradative substrates of DUBs We extend this method to profile the specificity of DUB activity USP7 has a broad ability to rescue degradation of newly identified DUB substrates Significance Dysregulation of protein degradation is a major driver of pathology in diseases such as cancer and neurodegenerative disorders.

Techniques: Virus, Recombinant, Ubiquitin Proteomics, Plasmid Preparation, Software

Journal: Immunity

Article Title: microRNA-142 is critical for the homeostasis and function of type-1 innate lymphoid cells

doi: 10.1016/j.immuni.2019.06.016

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: 16% Paraformaldehyde Aq Sol., Case of 10 Fisher 50-980-489 DMEM Media Gibco 11965 DMSO Sigma D2650 EDTA Corning 46-034-CL Heparin Fresenius Kabi USA 401807K AO/PI Nexcelom CS2-0106-5ML Ethyl Alcohol 200 Proof Pharmco Cat #11100020S Critical Commercial Assays EasySepTM Mouse NK Cell Isolation Kit Stem Cell Technologies Catalog # 19855 Direct-zol RNA Microprep Zymo Research R2061 PE Annexin V Apoptosis Detection Kit BD Bioscience Catalog No. 559763 Automacs NK Cell Isolation Kit Miltenyi CellTraceTM Yellow Cell Proliferation Kit, for flow cytometry Thermo Fisher CellTraceTM Violet Cell Proliferation Kit, for flow cytometry Thermo Fisher C34557 Promega Dual-Glo Luciferase Assay System, 10mL Thermo Fisher PR-E2920 Deposited Data MicroArray GEO GSE85476 Experimental Models: Cell Lines Mouse: 3T3 ATCC Human: 293T Sands Lab Experimental Models: Organisms/Strains Mouse: Mir142 −/− Reddy Lab n/a Mouse: Mir142 f/f Bolden Lab n/a Mouse: CD45.2 C57BL/6J The Jackson Laboratory Cat# JAX: 000664 Mouse: CD45.1 C57BL/6J The Jackson Laboratory Cat# JAX: 002014 Mouse: Ncr1-icre Vivier Lab Mouse: Il15 −/− Li Lab Oligonucleotides has-miR-142-3p, S(50RT/150 PCR rxns) Life Technologies 000464 has-miR-142-5p, S(50RT/150 PCR rxns) Life Technologies 002248 snoRNA135, TaqMan microRNA control Assay, S(50RT/150 PCR rxns) Life Technologies 001230 Software and Algorithms FlowJo Treestar Inc Automacs Miltenyi Biotec Cellometer Nexcelom GraphPad Prism 8 GraphPad Image Lab BioRad Open in a separate window KEY RESOURCES TABLE miR-142 is induced by IL-15 and required for type-1 ILC development and homeostasis miR-142 targets SOCS1 thereby promotes IL-15 receptor signaling in type-1 ILCs αV integrin, a miR142-3p target, promotes IL-15-independent survival in type-1 ILCs miR-142 is critical for cytokine production and NK cell-mediated viral control

Techniques: Virus, Recombinant, Derivative Assay, Saline, Electron Microscopy, Cell Isolation, Flow Cytometry, Luciferase, Microarray, Control, Software